Gene Information: col-129
| Name | col-129 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | M18.1 |
| Genetic position | IV:5.70 +/- 0.003 cM |
| Genomic position | IV: 12108734..12110439 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8821 | col-129(sy1528) IV. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-129. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ccgtctggcaccaaatgATGACTGTTGTCCCACA right flanking sequence: AGGAGGCAAGCAACGTCAAGTCTACGAGTCCCTGTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGACTGTTGTCCCACAAGG Method Reference: G3 (Bethesda). |