Gene Information: col-124
| Name | col-124 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C24F3.6 |
| Genetic position | IV:4.56 +/- 0.000 cM |
| Genomic position | IV: 10216451..10217617 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4450 | col-124(gk5525[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 325 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCGTCAAGCTGGAGAAGGAAACGGACAATG; Right flanking sequence: GGAGAAAACGGAAACAACGGTGAGCCACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |