Gene Information: col-120
| Name | col-120 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y11D7A.11 |
| Genetic position | IV:4.12 +/- 0.002 cM |
| Genomic position | IV: 9260610..9261787 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8819 | col-120(sy1526) IV. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-120. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTCTGGAATCATGTGCATTATTCTAATTCCTGGG right flanking sequence: CTTTACACATATCTACAATATATTCAAAGCTCTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTAGATATGTGTAAAGCCC Method Reference: G3 (Bethesda). |