| BC10699 |
dpy-5(e907) I; sEx10699. |
sEx10699 [rCes ZK154.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
| CZ2744 |
adm-4(ok265) X. |
Wild type. |
| PS7951 |
adm-4(sy1161) X. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of adm-4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTTGTTGATGACACGTTACATCTAGAGCCATCT Right flanking sequence: TACCCGCATCAACTTTCTGATGATCTTGGGCCTGTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GAAAGTTGATGCGGGTAAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| VC304 |
adm-4(ok265) X. |
ZK154.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |