Gene Information: C25H3.7

NameC25H3.7 View on WormBase
Species C. elegans
SequenceC25H3.7
Genetic positionII:-0.97 +/- 0.000 cM
Genomic positionII: 5666756..5668930

Strains carrying this gene

Strain Genotype Description
RG3219 C25H3.7(ve719[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 2210 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaatcagtcgtctacaacacatcttcttg ; Right flanking sequence: CGGACTGCATtctgaaagagaaaaaatata. sgRNA #1: tatTCAATCGTCTCTCCACT; sgRNA #2: AGTTTTACCCAAGTTGAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.