| RG3202 |
+/szT1[lon-2(e678) umnIs61] I; ZK899.2(ve702[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. |
umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Larval lethal. Deletion of 2110 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 early larval lethal (ve702 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tttaaaaaacgtagcacgcgtattttttac ; Right flanking sequence: tggaaaataattatatttcaactttgaaca. sgRNA #1: cttcaacttctctgacacag; sgRNA #2: tttcacaatttactagtaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |