Gene Information: nlp-6
| Name | nlp-6 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T23E7.4 |
| Genetic position | X:24.58 +/- 0.000 cM |
| Genomic position | X: 17662446..17665216 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8674 | nlp-6(sy1449) X. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCGACTCGCCTTCGTTCTTCTCGTCTCGGCGTGCG right flanking sequence: TCATGGCAATGGCTGCTCCAAAACAAATGGTGTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCTCGTCTCGGCGTGCGTCA Method Reference: G3 (Bethesda). |