Gene Information: nlp-9
| Name | nlp-9 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | E03D2.2 |
| Genetic position | V:-6.29 +/- 0.010 cM |
| Genomic position | V: 4219642..4222233 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8676 | nlp-9(sy1451) V. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-9. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gaaaaaaagagagATGGATCGATTCGCCACCAGAT right flanking sequence: TTATCGCCCTTCTTCTGGTTCTTTTACAAATTGgtg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGAAGAAGGGCGATAAATC Method Reference: G3 (Bethesda). |