Gene Information: oac-2

Nameoac-2 View on WormBase
Species C. elegans
SequenceC02A12.8
Genetic positionV:-11.21 +/- 0.060 cM
Genomic positionV: 3471870..3475121

Strains carrying this gene

Strain Genotype Description
PS8201 oac-2(sy1218) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aattgtggaatttttagATTTCGAAGAATCCTCCC Right flanking sequence: GCTGTACTACTTGACCATCTTCCTCATAGTAGTCATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGTGGCATTACGAAGGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616