Gene Information: cpn-4
| Name | cpn-4 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F49D11.8 |
| Genetic position | I:5.90 +/- 0.034 cM |
| Genomic position | I: 10924240..10925750 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8010 | cpn-4(sy1172) I. | Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of cpn-4 (F49D11.8). Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGCAAGCAAGTTCAATGATGTTGAAGCTGGATACT; right flanking sequence: TGTTGGAATGGATTCGGgtaagatttgggtagatt; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda). |