Gene Information: dmsr-8

Namedmsr-8 View on WormBase
Species C. elegans
SequenceC35A5.7
Genetic positionV:2.57 +/- 0.000 cM
Genomic positionV: 10510443..10514371

Strains carrying this gene

Strain Genotype Description
PS8856 dmsr-8(sy1541) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-8; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATATTCATCCGTACGTCTCTGTGATTCTCTGTCT Right flanking sequence: TGCAGgttggttattatgaagtgatcgcacatgttg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCTGTGATTCTCTGTCTTGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616