Gene Information: nlp-73
| Name | nlp-73 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | ZK287.3 |
| Genetic position | V:2.07 +/- 0.000 cM |
| Genomic position | V: 9678277..9679302 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8693 | nlp-73(sy1465) V. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-73. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTGCTCATCGCGACCACTGTGCTCATCGCCGAGT right flanking sequence: CTCGTGTATTCTATAACCGATTCGACGGCGGGCTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTATAGAATACACGAGACT Method Reference: G3 (Bethesda). |