Gene Information: dmsr-7

Namedmsr-7 View on WormBase
Species C. elegans
SequenceC35A11.1
Genetic positionV:-2.10 +/- 0.000 cM
Genomic positionV: 5405353..5408386

Strains carrying this gene

Strain Genotype Description
PS8854 dmsr-7(sy1539) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-7; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGCTCAGTTGTTTGATCCGAACAGTAACAGTA Right flanking sequence: CGCAGGCATTTCTTCGGAAACTTGCACATTTTCAAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCGAACAGTAACAGTACGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616