Gene Information: nlp-19

Namenlp-19 View on WormBase
Species C. elegans
SequenceK09C8.6
Genetic positionX:2.73 +/- 0.000 cM
Genomic positionX: 10958727..10959253

Strains carrying this gene

Strain Genotype Description
PS8682 nlp-19(sy1457) X. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-19. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ctctactgttgtatattcttcttcacaATGCTCTT right flanking sequence: ACGCGGTGTATGCCTTGCTCTTCTCATTCTAGTCAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTTCACAATGCTCTTACG Method Reference: G3 (Bethesda).