Gene Information: nlp-13

Namenlp-13 View on WormBase
Species C. elegans
SequenceE03D2.1
Genetic positionV:-6.26 +/- 0.005 cM
Genomic positionV: 4236418..4238056

Strains carrying this gene

Strain Genotype Description
PS8678 nlp-13(sy1453) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-13. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGATCTCTTCAGATCTTCTGCATCATGTCCGCCA right flanking sequence: TCGCAATGGCATACAGTCAAGgtttgtgttgtgtc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACTGTATGCCATTGCGATGG Method Reference: G3 (Bethesda).