Gene Information: nlp-13
Name | nlp-13 View on WormBase |
---|---|
Species | C. elegans |
Sequence | E03D2.1 |
Genetic position | V:-6.26 +/- 0.005 cM |
Genomic position | V: 4236418..4238056 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
PS8678 | nlp-13(sy1453) V. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-13. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGATCTCTTCAGATCTTCTGCATCATGTCCGCCA right flanking sequence: TCGCAATGGCATACAGTCAAGgtttgtgttgtgtc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACTGTATGCCATTGCGATGG Method Reference: G3 (Bethesda). |