Gene Information: oac-44
| Name | oac-44 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T09E11.5 |
| Genetic position | I:13.16 +/- 0.001 cM |
| Genomic position | I: 12356942..12359341 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8630 | oac-44(sy1431) I. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-44. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTCTCGGATTCCACTTCTACCCAAACCAGTTTCC right flanking sequence: CAATGGATACCTCGGAGTGGATCAgttaggtttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACCCAAACCAGTTTCCCAA Method Reference: G3 (Bethesda). |