Gene Information: oac-40

Nameoac-40 View on WormBase
Species C. elegans
SequenceR03H4.1
Genetic positionV:1.91 +/- 0.000 cM
Genomic positionV: 9016779..9019359

Strains carrying this gene

Strain Genotype Description
PS8301 oac-40(sy1258) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-40; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTACCAAATTTCTTATGGGAAACTAATAACCGGTA Right flanking sequence: TTCGTTGGCTTCATTATTTTTAGTCACAAATCAAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATAATGAAGCCAACGAATAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616