Gene Information: oac-35

Nameoac-35 View on WormBase
Species C. elegans
SequenceF56H6.11
Genetic positionI:13.12 +/- 0.001 cM
Genomic positionI: 12307731..12310431

Strains carrying this gene

Strain Genotype Description
PS8538 oac-35(sy1390) I. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-35. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTTCTAATGTGCATGTTGCTCAAGCGTGCCGAGA right flanking sequence: CCCACCCATTTTTCACGTTGTTATGCACATTTTAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGTGAAAAATGGGTGGGTCT Method Reference: G3 (Bethesda).