Gene Information: acs-10

Nameacs-10 View on WormBase
Species C. elegans
SequenceAH10.1
Genetic positionV:6.18 +/- 0.003 cM
Genomic positionV: 14146499..14148839

Strains carrying this gene

Strain Genotype Description
PS8542 acs-10(sy1394) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of acs-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTCTGGACTCATGTCGTATCCATGCAGCCGCCA right flanking sequence: ATAAGGACGCCATAGTTTTTgtgagtacggatttatc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACTATGGCGTCCTTATTGG Method Reference: G3 (Bethesda).