Gene Information: oac-24

Nameoac-24 View on WormBase
Species C. elegans
SequenceF39G3.6
Genetic positionV:-4.62 +/- 0.017 cM
Genomic positionV: 4710764..4715011

Strains carrying this gene

Strain Genotype Description
PS8250 oac-24(sy1246) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-24; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aaaaaatttcagATTCTTTGTCATTTCCGGATACC Right flanking sequence: TCATGGCGAAAAATTTAACGAAGACTAAACTTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGTCATTTCCGGATACCTCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616