Gene Information: srw-36

Namesrw-36 View on WormBase
Species C. elegans
SequenceF14F8.7
Genetic positionV:10.98 +/- 0.012 cM
Genomic positionV: 16683186..16684174

Strains carrying this gene

Strain Genotype Description
PS8252 srw-36(sy1248) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srw-36; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGACTGTTAACCAATTTCTGATAGGTATCGTAGT Right flanking sequence: TTGTGGGATTATCCACAATGTATGTAGTATCATC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGATAGGTATCGTAGTTTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616