Gene Information: srw-54

Namesrw-54 View on WormBase
Species C. elegans
SequenceY32B12C.2
Genetic positionV:10.74 +/- 0.005 cM
Genomic positionV: 16611335..16612703

Strains carrying this gene

Strain Genotype Description
PS8234 srw-54(sy1234) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srw-54; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: TTTGGTACGATCTGCAAAACATCATCAGGCCTATT Right flanking sequence: GATGTGTACTTGGATTACTTCAACTTTTCAATATC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAATCCAAGTACACATCAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616