Gene Information: gnrr-4

Namegnrr-4 View on WormBase
Species C. elegans
SequenceC41G11.4
Genetic positionX:-4.38 +/- 0.002 cM
Genomic positionX: 5738756..5743309

Strains carrying this gene

Strain Genotype Description
PS8120 gnrr-4(sy1196) X. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of gnrr-4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGACTGCATCGTTCTCTTTATCTACGCTCCAACT Right flanking sequence: CAGTTTGCATGGATTCACTCATACTGGgtaagtctg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAATCCATGCAAACTGAGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616