Gene Information: tsp-19

Nametsp-19 View on WormBase
Species C. elegans
SequenceD2092.7
Genetic positionI:1.25 +/- 0.004 cM
Genomic positionI: 6616304..6618560

Strains carrying this gene

Strain Genotype Description
VC4213 tsp-19(gk5299) I. Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5299 mutation is G->A, flanking sequences AAAAGTCATATAATGACATATGTAAACCCG and TGAGTGACGGATTGAATGAAGTCCATTATC.