Gene Information: otpl-8

Nameotpl-8 View on WormBase
Species C. elegans
SequenceH19J13.1
Genetic positionX:7.02 +/- 0.000 cM
Genomic positionX: 12266953..12270941

Strains carrying this gene

Strain Genotype Description
PS8990 otpl-8(sy1592) X. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-8; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATCACCCACACATCATCATGAACTCTACCGACGA Right flanking sequence: CCTTGGATTCATGAGCCAAGAGCCACgtaagtctag inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATGAACTCTACCGACGACCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616