Gene Information: otpl-7

Nameotpl-7 View on WormBase
Species C. elegans
SequenceF45F2.7
Genetic positionV:1.43 +/- 0.001 cM
Genomic positionV: 8521503..8524678

Strains carrying this gene

Strain Genotype Description
PS8988 otpl-7(sy1590) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-7; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGTCAGTGTTGCGAGTACATCAACAGCCCCACTT Right flanking sequence: GATCATGTCACAGTTCCAAATGCTCTTCCATCAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAACTGTGACATGATCAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616