Gene Information: lgc-8
| Name | lgc-8 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y57G11C.49 |
| Genetic position | IV:12.40 +/- 0.004 cM |
| Genomic position | IV: 14715800..14720440 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8749 | lgc-8(sy1508) IV. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGGTATCAGAGCAGTTGAAGGATGTTCTTATGGAA right flanking sequence: Ggttggtattgatttagttcaccaaaaagagtttag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGGATGTTCTTATGGAAGGT Method Reference: G3 (Bethesda). |