Gene Information: otpl-5

Nameotpl-5 View on WormBase
Species C. elegans
SequenceF45F2.5
Genetic positionV:1.44 +/- 0.001 cM
Genomic positionV: 8529519..8532465

Strains carrying this gene

Strain Genotype Description
PS8943 otpl-5(sy1586) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-5; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAGAGCACAAGCACATCGGTAGCAATGTCCACAT Right flanking sequence: CAGACGGGTTCAGTAGCCATGACGATATTTCACAATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTACTGAACCCGTCTGATG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616