Gene Information: otpl-6

Nameotpl-6 View on WormBase
Species C. elegans
SequenceF45F2.6
Genetic positionV:1.44 +/- 0.001 cM
Genomic positionV: 8526074..8528580

Strains carrying this gene

Strain Genotype Description
PS8945 otpl-6(sy1588) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-6; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGAATCTACATCCAGCGATGTTACTGTCCTAAC Right flanking sequence: AGACTATAGCAGTACTATTCCAGAAAATCTTCCG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAGTACTGCTATAGTCTGTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616