Gene Information: otpl-3

Nameotpl-3 View on WormBase
Species C. elegans
SequenceF14B8.7
Genetic positionX:-2.00 +/- 0.000 cM
Genomic positionX: 6921646..6924764

Strains carrying this gene

Strain Genotype Description
PS8940 otpl-3(sy1583) X. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTCGTCAAATTGTTCTACAATTGCAACACCCAAC Right flanking sequence: AGCAAAGTCAGATTTCGGTATCATGAGAAACGATATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGAAATCTGACTTTGCTGTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616