Gene Information: otpl-2

Nameotpl-2 View on WormBase
Species C. elegans
SequenceD1065.1
Genetic positionV:-6.66 +/- 0.024 cM
Genomic positionV: 4073755..4077573

Strains carrying this gene

Strain Genotype Description
PS8936 otpl-2(sy1579) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATGAAAATATGAAACGTTGGACGAAAAACCCGGAA Right flanking sequence: GCAAGgtaaaaagggaataactcaatataattc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGACGAAAAACCCGGAAGCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616