Gene Information: lgc-44
| Name | lgc-44 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F46F3.2 |
| Genetic position | V:3.25 +/- 0.004 cM |
| Genomic position | V: 11669338..11672597 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8741 | lgc-44(sy1500) V. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-44. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCTATTTCTCTTCTTTTTCTAATATTTCCACAT right flanking sequence: TCATCTAATCCTTCAAGCTCTAATTTTCTGGATATTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTGAAGGATTAGATGAATG Method Reference: G3 (Bethesda). |