Gene Information: lgc-32
| Name | lgc-32 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T19D7.1 |
| Genetic position | X:-19.51 +/- 0.000 cM |
| Genomic position | X: 672107..676484 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8713 | lgc-32(sy1483) X. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-32. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTGCACAAGTGATGAAGATGTGATTGCTGATCT right flanking sequence: CTTAGGAAGAAATTCACATTCTTCTGgtaacttattg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GATGTGATTGCTGATCTCTT Method Reference: G3 (Bethesda). |