Gene Information: dmsr-9

Namedmsr-9 View on WormBase
Species C. elegans
SequenceZC404.13
Genetic positionV:0.29 +/- 0.000 cM
Genomic positionV: 6798151..6799664

Strains carrying this gene

Strain Genotype Description
PS8861 dmsr-9(sy1546) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-9; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATATTTTAGCCAATATCCGGAAGCCAATAGTG Right flanking sequence: ACGAGGCAAAAGATTTGTTTATTACTTCATTGATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCGGAAGCCAATAGTGACG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616