Gene Information: lgc-18

Namelgc-18 View on WormBase
Species C. elegans
SequenceT01H10.7
Genetic positionX:7.01 +/- 0.000 cM
Genomic positionX: 12125608..12128000

Strains carrying this gene

Strain Genotype Description
PS8697 lgc-18(sy1469) X. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-18. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gtttttattcaaaatgttaattcttcattttgcagTTCCG right flanking sequence: GAATGGAACAATTTCTTGGAGAATCAAGTTAAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCATTTTGCAGTTCCGGAA Method Reference: G3 (Bethesda).