Gene Information: oac-57

Nameoac-57 View on WormBase
Species C. elegans
SequenceK09E10.1
Genetic positionIV:5.84 +/- 0.001 cM
Genomic positionIV: 12304464..12307820

Strains carrying this gene

Strain Genotype Description
PS8529 oac-57(sy1374) IV. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-57; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGATATCATTTGCATTCAATTTTATTCTTCCATCT Right flanking sequence: AAAGTCTCTTTTAACAGTTTGCTTGCAAGAATATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGTTAAAAGAGACTTTAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616