Gene Information: nlp-16
| Name | nlp-16 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T13A10.5 |
| Genetic position | IV:3.11 +/- 0.001 cM |
| Genomic position | IV: 6255049..6259832 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8680 | nlp-16(sy1455) IV. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-16. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCTTTCCCCATTGGAAAAGACAATGAATCCGACG right flanking sequence: AGTCCGAAGTTGAAGTGGATACCACAACTGAAGCTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACTTCAACTTCGGACTCGT Method Reference: G3 (Bethesda). |