Gene Information: nlp-16

Namenlp-16 View on WormBase
Species C. elegans
SequenceT13A10.5
Genetic positionIV:3.11 +/- 0.001 cM
Genomic positionIV: 6255049..6259832

Strains carrying this gene

Strain Genotype Description
PS8680 nlp-16(sy1455) IV. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-16. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCTTTCCCCATTGGAAAAGACAATGAATCCGACG right flanking sequence: AGTCCGAAGTTGAAGTGGATACCACAACTGAAGCTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACTTCAACTTCGGACTCGT Method Reference: G3 (Bethesda).