Gene Information: oac-22

Nameoac-22 View on WormBase
Species C. elegans
SequenceF37C4.2
Genetic positionIV:-1.95 +/- 0.018 cM
Genomic positionIV: 3885669..3888836

Strains carrying this gene

Strain Genotype Description
PS8367 oac-22(sy1286) IV. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-22; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACGCGTTACTTTTTGTGTCAAACAGACCAAAAA Right flanking sequence: CTGTGGCAGAGGACTATTTTACAATGgtaggtgctg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTCAAACAGACCAAAAACTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616