Gene Information: oac-52

Nameoac-52 View on WormBase
Species C. elegans
SequenceW03B1.8
Genetic positionIV:0.17 +/- 0.005 cM
Genomic positionIV: 4342262..4346612

Strains carrying this gene

Strain Genotype Description
PS8394 oac-52(sy1290) IV. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-52; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTCAAGGTATTCGAGGTCTTGCTATTACAGTTGT Right flanking sequence: ACTAGGTTTTCATTTCTATCCAGAAGCTTTTCCC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTTGCTATTACAGTTGTACT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616