Gene Information: nlp-78

Namenlp-78 View on WormBase
Species C. elegans
SequenceC16D2.2
Genetic positionII:1.05 +/- 0.000 cM
Genomic positionII: 9136178..9137560

Strains carrying this gene

Strain Genotype Description
PS8305 nlp-78(sy1262) II. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-78; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGCTTTCTCAAACATCTGTAGTGCGTATCCAGAT Right flanking sequence: TATCGACTTCCTGAAAGAgtaagttttgagaatttg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTTTCAGGAAGTCGATAATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616