Gene Information: oac-59

Nameoac-59 View on WormBase
Species C. elegans
SequenceC42C1.7
Genetic positionIV:5.84 +/- 0.001 cM
Genomic positionIV: 12293233..12301261

Strains carrying this gene

Strain Genotype Description
PS8303 oac-59(sy1260) IV. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-59; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCACCGTCTTCAAAACGGCTGGACCTTCAAGGCAT. Right flanking sequence: TAGAGGGTTGGCAATTCTATCAGTTCTGGGATTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGGACCTTCAAGGCATTAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616