Gene Information: clec-87

Nameclec-87 View on WormBase
Species C. elegans
SequenceC25A1.8
Genetic positionI:4.72 +/- 0.002 cM
Genomic positionI: 10184462..10185520

Strains carrying this gene

Strain Genotype Description
PS8544 clec-87(sy1396) I. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-87. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTTTTGCCTTCTCGTTGCTTTCATCCTTCCTGGG right flanking sequence: CTATTCCTCGTTCATGCAGCTCCGACTTCTTCAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCATGAACGAGGAATAGCCC Method Reference: G3 (Bethesda).