Gene Information: oac-51
Name | oac-51 View on WormBase |
---|---|
Species | C. elegans |
Sequence | W03B1.7 |
Genetic position | IV:0.16 +/- 0.005 cM |
Genomic position | IV: 4336801..4341306 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
PS8536 | oac-51(sy1388) IV. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-51. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gatttaataatttaggcATGGTAGTTTACACCGCT right flanking sequence: CTGTGGAACATTGAAGATCAAAATAAGCAATTTAAAAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGGTAGTTTACACCGCTCTG Method Reference: G3 (Bethesda). |