Gene Information: oac-58
| Name | oac-58 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | K09E10.2 |
| Genetic position | IV:5.85 +/- 0.001 cM |
| Genomic position | IV: 12308293..12311697 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8531 | oac-58(sy1376) IV. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-58. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGATCTCATTCACATTCTATTCAATTCTCCCACT right flanking sequence: TGAAGTGGCTTTTAACAGTTTATTTGCAAGAATATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTTAAAAGCCACTTCAAGT Method Reference: G3 (Bethesda). |