Gene Information: pals-14

Namepals-14 View on WormBase
Species C. elegans
SequenceF22G12.1
Genetic positionI:17.22 +/- 0.000 cM
Genomic positionI: 13139122..13141898

Strains carrying this gene

Strain Genotype Description
PS8179 pals-14(sy1205) I. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-14; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: TTAAATCCAGTTTAGCAGAGAGAAAAGCGGCAGAG Right flanking sequence: GAGAGGCACAACAAAGCGgtatgatcatgcttacc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAGAAAAGCGGCAGAGGAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616