Gene Information: ttc-36

Namettc-36 View on WormBase
Species C. elegans
SequenceF52H3.5
Genetic positionII:1.82 +/- 0.000 cM
Genomic positionII: 10030190..10030970

Strains carrying this gene

Strain Genotype Description
PS7962 ttc-36(sy1167) II. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ttc-36; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGCTCAGTTTGCAGCTCGAGAGAGAAGGTGTCG Right flanking sequence: cCGTTGGCAGAAGGTGTACGGTTGGATGAAGCTATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGAGAGAGAAGGTGTCGCGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616