Gene Information: D2005.4

NameD2005.4 View on WormBase
Species C. elegans
SequenceD2005.4
Genetic positionI:2.37 +/- 0.000 cM
Genomic positionI: 7814949..7819413

Strains carrying this gene

Strain Genotype Description
VC4214 D2005.4(gk5300) I. Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5300 mutation is G->A, flanking sequences AATCTTGATTTTAAATGCGAACGATTTTCA and GGCGAAGACTACAATGTGCAGCAGGCAAAA.