Gene Information: clec-91
| Name | clec-91 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | ZK858.3 |
| Genetic position | I:3.61 +/- 0.000 cM |
| Genomic position | I: 9126140..9127101 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8584 | clec-91(sy1415) I. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-91. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGACCTACATCCTTATCATCGTCCCACTGATCAT right flanking sequence: CATTGGAGGCGGTGTCGTCGCTGACAACACAAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATCGTCCCACTGATCATCAT Method Reference: G3 (Bethesda). |
| VC4181 | clec-91(gk5267) I. | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5267 mutation is C->T, flanking sequences AATGCGCTGGTGCCAAGATCCTTGTGGTCC and AGTTGTAGTATGTCACTGTAAGATTGATTA. |