Gene Information: clec-47
| Name | clec-47 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T09F5.9 |
| Genetic position | V:7.49 +/- 0.000 cM |
| Genomic position | V: 15175759..15176324 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8825 | clec-47(sy1532) V. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-47. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCATTTTTGTACTTGCAATTTTTATATTTCCAATT right flanking sequence: GCTTCAATTTCGTGTCCAAGTGGCTTTACACTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGACACGAAATTGAAGCAAT Method Reference: G3 (Bethesda). |